Plasmodium falciparum infection reshapes the human microRNA profiles of red blood cells and their extracellular vesicles

•Nine miRNAs were highly expressed in red blood cells after P. falciparum infection•Members of the let-7 family downregulated infection•Hsa-miR-451a was most abundant secreted miRNA within RBCs•The identified target genes that play roles immune responses Plasmodium falciparum, a human malaria parasite, develops (RBCs), which represent approximately 70% all cells. Additionally, RBC-derived extracellular vesicles (RBC-EVs) 7.3% total EV population. The microRNAs (miRNAs) consequences infection are unclear. Here, we analyzed profiles non-infected RBCs (niRBCs), ring-infected (riRBCs), and trophozoite-infected (trRBCs), as well those EVs from these Hsa-miR-451a RBC RBC-EV populations, but its expression level not affected by infection. Overall, their altered significantly Most differentially shared between EVs. A prediction analysis revealed possible identity targeted (CXCL10, OAS1, IL7, CCL5) involved immunomodulation. Malaria has major impact on health worldwide. According to World Health Organization, killed 627,000 people 2020, representing 12% increase death rate 2019, attributed service disruption due COVID-19 pandemic. Notably, 77% malaria-related deaths 2020 children under 5 years age.1WHOWHO Report 2021. WHO, 2021Google Scholar In same year, 11.6 million pregnant women diagnosed with infection, resulting 819,000 low birth weight.1WHOWHO is caused five species genus Plasmodium, although responsible for deaths.1WHOWHO Cerebral (CM) severe neurological complication pathogenic basis CM poorly understood, cytoadhesion host response thought be involved. Red (RBCs) have long been recognized perfect shelter parasitic invaders, providing them only food resources also protection against attacks. Upon entry into RBCs, uses different strategies survive. For example, parasite changes morphology infected (iRBCs) inducing production knob-like protrusions cell surface.2Rug M. Prescott S.W. Fernandez K.M. Cooke B.M. Cowman A.F. role KAHRP domains knob formation cytoadherence P falciparum-infected erythrocytes.Blood. 2006; 108: 370-378Crossref PubMed Scopus (112) Google These provide scaffold correct presentation parasite’s virulence protein, erythrocyte membrane protein 1 (PfEMP1), thereby stabilizing binding iRBCs endothelial (EC) receptors.3Kyes S. Horrocks Newbold C. Antigenic variation at surface malaria.Annu. Rev. Microbiol. 2001; 55: 673-707Crossref (309) Scholar,4Newbold Craig A. Kyes Rowe Fernandez-Reyes D. Fagan T. Cytoadherence, pathogenesis falciparum.Int. J. Parasitol. 1999; 29: 927-937Crossref (123) main function terminally differentiated oxygen transportation via hemoglobin. During differentiation mature form, gradually lose cellular organelles lot nucleic acid content (the long-held belief lack DNA RNA now wrong). sequencing (RNA-seq) technologies contain some mRNAs (miRNAs).5Chen S.Y. Wang Y. Telen M.J. Chi J.T. genomic microRNA sickle diseases.PLoS One. 2008; 3: e2360Crossref (140) Scholar,6Kannan Atreya Differential profiling during storage 52 selected microRNAs.Transfusion. 2010; 50: 1581-1588Crossref (55) Scholar,7Sangokoya Lamonte G. Isolation characterization erythrocytes.Methods Mol. Biol. 667: 193-203Crossref Scholar,8Lamonte Philip N. Reardon Lacsina J.R. Majoros W. Chapman L. Thornburg C.D. Ohler U. Nicchitta C.V. et al.Translocation inhibits translation contributes resistance.Cell Host Microbe. 2012; 12: 187-199Abstract Full Text PDF (215) Indeed, recent estimates suggested express 8,092 359 miRNAs.9Azzouzi I. Moest H. Wollscheid B. Schmugge Eekels J.J.M. Speer O. Deep proteomic microRNA-induced silencing complex cells.Exp. Hematol. 2015; 43: 382-392Abstract (23) Scholar,10Doss J.F. Corcoran D.L. Jima D.D. Dave S.S. comprehensive joint short transcriptomes erythrocytes.BMC Genomics. 16: 952Crossref (74) Many RBC-mRNAs encode proteins associated erythroid differentiation. addition, initiation, activation, regulation transcription (such polymerases I, II, III; zinc/ plant homeodomain (PHD) finger DNA-binding proteins; cysteinyl- lysyl-tRNA synthetases), important RNA-stabilizing factors poly(A)-binding antiapoptotic beclin 1, reticulon 4, B-cell lymphoma 2 [BCL2], inhibitor apoptosis [IAP]).11Kabanova Kleinbongard Volkmer Andrée Kelm Jax T.W. Gene cells.Int. Med. Sci. 2009; 6: 156-159Crossref small noncoding RNAs inhibit 60% protein-coding genes. Direct interaction through complementary base pairing leads cleavage mRNAs.12Bartel D.P. MicroRNAs: recognition regulatory functions.Cell. 136: 215-233Abstract (16145) high concentration causes hypermethylation encoding mRNAs, downregulation gene transcription.13Khraiwesh Arif M.A. Seumel G.I. Ossowski Weigel Reski R. Frank Transcriptional control microRNAs.Cell. 140: 111-122Abstract (387) Under normal physiological conditions, unique each organ. Pathogen invasion dysregulation profiles.14Liang Ridzon Wong Chen Characterization tissues.BMC 2007; 8: 166Crossref (876) Scholar,15Zhou M.H. Zhang Song Sun W.J. MicroRNA-218 prevents lung injury sepsis inhibiting RUNX2.Eur. Pharmacol. 2018; 22: 8438-8446PubMed Some pathogens preferentially invade certain tissues, leading tissue-specific alterations profiles16Chakraborty Sharma A.R. Doss C.G.P. Lee Therapeutic siRNA: Moving Bench Clinic Next Generation Medicine.Mol. Ther. Nucleic Acids. 2017; 132-143Abstract (538) can either lead or effect invading organism.17Ruiz-Tagle Naves Balcells M.E. Unraveling Role MicroRNAs Mycobacterium tuberculosis Infection Disease: Advances Pitfalls.Infect. Immun. 2020; 88: e00649-19Crossref (14) Scholar,18Sun Yu Niu Blood Cells Potential Repositories Circulatory System.Front. Genet. 11: 442https://doi.org/10.3389/fgene.2020.00442Crossref (32) RBC-miRNAs key hematopoiesis maturation RBCs6Kannan Scholar,19Chen Liu Chao Yan X. Gong Qiang Yuan Peng MicroRNA-21 down-regulates tumor suppressor PDCD4 glioblastoma T98G.Cancer Lett. 272: 197-205Crossref (195) Scholar,20Juzenas Venkatesh Hübenthal Hoeppner M.P. Du Z.G. Paulsen Rosenstiel Senger Hofmann-Apitius Keller al.A comprehensive, specific catalogue peripheral blood.Nucleic Acids Res. 45: 9290-9301Crossref (119) Scholar,21Ryan microRNAs: what they future do hold?.Transfus. 2011; 25: 247-251https://doi.org/10.1016/j.tmrv.2011.01.005Crossref Scholar,22Teruel-Montoya Kong Abraham Ma Kunapuli S.P. Holinstat Shaw C.A. Mckenzie S.E. Edelstein L.C. Bray P.F. MicroRNA differences hematopoietic lineages enable regulated transgene expression.PLoS 2014; 9: e102259Crossref (65) development diseases such atherosclerosis.23Li K.Y. Zheng Q. Hu Y.W. Characteristics erythrocyte-derived microvesicles relation atherosclerosis.Atherosclerosis. 2016; 255: 140-144Abstract Six date, namely, miR-451a, miR-144-3p, miR-16, miR-92a, let-7, miR-486-5p.10Doss phenotype enriched growth inhibition translational repression mRNAs.8Lamonte Chakrabarti colleagues reported miR-197-5p apicortin affects growth.24Chakrabarti Garg Rajagopal Pati Singh Targeted impairs invasion.Dis Model Mech. 13: dmm042820https://doi.org/10.1242/dmm.042820Crossref (16) Adding this, other researchers postulated RNA-induced (RISC) imported might interact mRNA regulate stability translation.25Dandewad V. Vindu Joseph Seshadri Import miRNA-RISC expression.J. Biosci. 2019; 44: 50Crossref (15) Currently, minimal information available complications. our knowledge, RBC-miRNA profile yet performed. Viable communicate indirectly releasing (EVs) miRNAs, proteins. formed inside multivesicular bodies (exosomes) directly plasma (microvesicles). released coupled Argonaute 2; complexes alter types upon uptake RBC-EVs.26Arroyo J.D. Chevillet Kroh E.M. Ruf I.K. Pritchard C.C. Gibson D.F. Mitchell P.S. Bennett C.F. Pogosova-Agadjanyan E.L. Stirewalt al.Argonaute2 carry population circulating independent plasma.Proc. Natl. Acad. USA. 5003-5008Crossref (2577) Scholar,27Mantel P.Y. Hjelmqvist Walch Kharoubi-Hess Nilsson Ravel Ribeiro Grüring Padmanabhan al.Infected vascular Ago2-miRNA malaria.Nat. Commun. 7: 12727Crossref Scholar,28Mantel Marti protozoan parasites.Cell 344-354Crossref (93) Scholar,29Willeit Zampetaki Dudek K. Kaudewitz King Kirkby N.S. Crosby-Nwaobi Prokopi Drozdov Langley S.R. al.Circulating novel biomarkers platelet activation.Circ. 2013; 112: 595-600Crossref (322) Scholar,30Zhang Roccaro A.M. Rombaoa Flores Obad Fernandes S.M. Sacco Ngo Quang al.LNA-mediated anti-miR-155 low-grade lymphomas.Blood. 120: 1678-1686https://doi.org/10.1182/blood-2012-04-425207Crossref (40) Scholar,31Vu Ragupathy Kulkarni Analysis 2-microRNA ex vivo stored cells.Transfusion. 57: 2995-3000https://doi.org/10.1111/trf.14325Crossref identify potential played examined levels RBC-miRNAs, RBC-EV-miRNAs, both (niRBCs) iRBCs. Further investigations this area could inspire miRNAs-based therapeutics. An overview procedure used isolate characterize shown (Figure 1A). niRBCs cultivated described previously.32Trager Jensen J.B. Human parasites continuous culture. 1976.J. 2005; 91: 484-486Crossref (160) culture tightly synchronized enrich stage-specific isolation miRNA, mRNA, (ring-stage [riRBCs] trophozoite-stage [trRBCs]).33Lambros Vanderberg J.P. Synchronization erythrocytic stages culture.J. 1979; 65: 418-420Crossref isolated controls. RBC-EVs purified supernatants niRBCs, riRBCs, trRBCs, previously.28Mantel Subsequently, RBC-EV-miRNAs isolated. subjected next-generation (NGS), obtained sequences aligned miRNA/transcriptome reference sequences. Transmission electron microscopy following incubation an antibody targeting cluster 235a (CD235a), membrane-bound sialoglycoprotein present confirmed did indeed originate trRBCs 1B). This displayed expected circular morphology,34Pisitkun Shen R.F. Knepper Identification exosomes urine.Proc. 2004; 101: 13368-13373Crossref (1664) Scholar,35Szatanek Baj-Krzyworzeka Zimoch Lekka Siedlar Baran Methods Choice Extracellular Vesicles Characterization.Int. 18: 1153Crossref (274) average size 150–200 nm. nanoparticle tracking assay three populations 100–250 nm 1C). previous study using NGS 287 known 72 putative RBC-miRNAs.10Doss later found several including miR-451, miR-486-5p, RBCs.36Wu C.W. Cao Berger C.K. Foote P.H. Mahoney D.W. Simonson J.A. Anderson B.W. Yab T.C. Taylor W.R. Boardman L.A. al.Novel Approach Fecal Occult Testing Assay Erythrocyte-Specific Markers.Dig. Dis. 62: 1985-1994Crossref (22) miR-451a similar types, normalized 17×106, 16.7×106, 15.7×106, respectively. Similarly, differ 8.6×105, 6.5×105, 6.8×105, respectively 2). Next, C-C motive chemokine ligand (CLC) Genomics software V22 riRBCs versus niRBCs. Clean reads miRbase v22 database. 206 26 upregulated (fold change >5), respectively, 3A). Furthermore, 321 53 3B). Figure 3C shows heatmap top 50 (see Table S1). To generate heatmap, values (total counts) differential CLC V22, statistical significance calculated 10% false discovery (FDR)-adjusted p value. showed very low, homogeneous (RBCs 1–6 3E). However, marked color evident (Rings 1–9 Trophs 3C), indicating increased miRNAs. general, slightly harvested 4–6 h postinvasion 1–3 3C) more prominently 8–14 4–9 3C). raw deposited NCBI (Bioproject Number: PRJNA897869). comparison distribution 63 downregulated, riRBC-EVs niRBC-EVs 3D). 144 trRBC-EVs 3F 12 S2). generated earlier section. As seen majority uninfected 1–5 3F), 3F). 393 cutoff ≥2). common 30 3G). subsections focus nine (those highest significance) Ingenuity Pathway (IPA) software. candidates listed 1.Table 1Top iRBCs-EVsmiRNAAccession numberSequenceTarget (Predicted)hsa-miR-6499-3pMIMAT0025451AGCAGUGUUUGUUUUGCCCACANFKBIAhsa-miR-432-5pMIMAT0025450UCGGGCGCAAGAGCACUGCAGUIL7hsa-miR-585-5pMIMAT0026618CUAGCACACAGAUACGCCCAGAIL6SThsa-miR-12131MI0039733UCCCUGCCCUUUAUUUGGGAGUACACCUCUCCAAAUAUACAGUUAACUGAUGUUUUACUGUUUAUUUGGAGAGGUGUACUCCCAAAUAAAGGGCAUACCCUC-hsa-miR-1245b-5pMI0017431UUUAUAUGUAGGCCUUUAGAUCACUUAAAGAGUAUUCAACAUCAGAUGAUCUAAAGGCCUAUACAUAAAMAPK13hsa-miR-662MI0003670GCUGUUGAGGCUGCGCAGCCAGGCCCUGACGGUGGGGUGGCUGCGGGCCUUCUGAAGGUCUCCCACGUUGUGGCCCAGCAGCGCAGUCACGUUGCLTBRhsa-miR-148a-5pMI0000253GAGGCAAAGUUCUGAGACACUCCGACUCUGAGUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUCIL22hsa-miR-9500MI0029185AAAAGGGAAGAUGGUGACCACAUAGGAGGGACAGCGGCCUUUCCAACAGGGGACCCUUGCCAGCCCXCL10hsa-miR-12136MI0039740GAAAAAGUCAUGGAGGCCAUGGGGUUGGCUUGAAACCAGCUUUGGGGGGUUCGAUUCCUUCCUUUUUUGUC-∗Relative KD: predicted convolutional neural network (CNN) predicts affinity any 12-nt sequence (Targetscan V8 Human). Open table new tab ∗Relative hsa-miR-6499-3p 4A). NFKBIA miR-6499-3p. acute phase signaling, activation neutrophils T (Tables S3 S4). ULBP3, natural killer (Figures 5A 5B ) S4).Figure 5Functional candidatesShow full caption(A) STRING clustering 4. Four clusters K-means clustering: blue (immune-regulatory interactions), (plasma signaling), yellow (HIF-1 phagosome pathways), green (cytokine receptor activity chemotaxis). pink connector lines database experimentally interactions, respectively.(B) g:Profiler graph showing significant biological pathways Transmembrane signaling pathway, followed various communication pathways.View Large Image ViewerDownload Hi-res image Download (PPT) (A) (B) pathways. hsa-miR-432-5p 4B). Among others, interlukin-7 (IL7), IL7 JAK1/JAK2 cytokine pathways, miR-432-5p 5B) hsa-miR-585-5p 4C). interlukin-6 (IL6ST) miR-585-5p. IL6ST pathway IL6 hsa-miR-12131 4D). No targets miRNA. hsa-miR-1245b-5p 4E). MAPK13, plays lymphocyte miR-1245b-5p hsa-miR-662 4F). LTBR, intercellular crosstalk dendritic cells, miR-662 hsa-miR-148a-5p 4G). miR-148a-5p interferon signaling. interlukin-22 (IL22) hsa-miR-9500 4H). miR-9500 C-X-C motif 10 (CXCL10), mediates innate adaptive systems hsa-miR-12136 4I). IPA aforementioned candidates. S4 lists functions. Search Tool Retrieval Interacting Genes/Proteins (STRING) method allocate encoded four according experimental records databases 5A). includes 19 nodes corresponding related immune-regulatory interactions. consists 23 contains hypoxia-inducible factor (HIF-1) Finally, 18 chemotaxis (for example: CXCL10, CCL5, necrosis super 4 [TNFSF4]) 5B). Members immunomodulatory 6 members iRBCs, let-7a-5p let-7d-5p 6A 6B). Within EVs, hsa-let-7a-5p trRBC-EVs, let-7f let-7g (versus niRBCs), 6C 6D). Our findings analyses prompted us examine whether end, performed extracted transcriptome RNA-seq V22. FDR-adjusted detect 7A statistically 20 upregulated, (Table We percentages dominant transcripts riosomal protiens (RPS12) L ribosomal 41 (RPL41) represented 19% 11% transcripts, two cytoplasmic ribosomes. RPS12 RPL41, ribosomes, 7B). signific